Please see http://z.umn.edu/ris-rnaseq/ for the latest version of this tutorial document!

RNASeq Analysis With CHURP

Last Updated: 2026-05-27
Last Delivered: 2026-04-07

Check out the recording of this tutorial and other MSI tutorials on our YouTube channel: https://www.youtube.com/@UofMMSI/videos

Expand all details (Useful for printing!)
Collapse all details

Part 0: Introduction

This tutorial will cover the basic use of the CHURP workflow for bulk RNAseq data analysis. The tools are used via the Linux command line. We cover important aspects of data QC and considerations to take when interpreting RNAseq results.

CHURP is published here: https://doi.org/10.1145/3332186.3333156 and is fully supported by RI:Bioinformatics.

Outline

Return to top

Part 0.1: Goals

By the end of this tutorial you should be able to:

Return to top

Part 0.2: Scope of the Tutorial

What this tutorial covers

What this tutorial DOESN’T cover

For discussion of project-specific settings and next steps, see the supplementary sections at the end of this document.

Return to top

Part 0.3: Prerequisites

  1. Ability to access MSI’s agate cluster on the command line:

https://www.msi.umn.edu/content/connecting-hpc-resources

  1. Command line navigation. While we will go over the commands needed for submitting CHURP, a more detailed linux command line guide is here:

https://pages.github.umn.edu/dunn0404/intro-to-linux/

or here:

http://hpcc.ucr.edu/manuals_linux-basics_cmdline-basics.html

  1. Biology behing RNASeq (central dogma, molecular bio, etc.)

Return to top

Part 0.4: Formatting

Throughout this tutorial, there will be formatting cues to highlight various pieces of information.

This is just background information. There are no tutorial-related tasks in these boxes. Links to supporting material and further explanations of points we raise in the tutorial will appear like this.

This is a warning. Common pitfalls, cautionary information, and important points to consider will appear like this.

This is code, or a literal value that you must enter or select to run a part of the tutorial
These boxes contain detailed information. Click on them to expand them

When you click on these boxes, you will get a detailed view into a technical topic. The information in these boxes may be useful for advanced work beyond the scope of the tutorial We encourage you to read these, but they are not essential to completing the tutorial!

Part 1: Bulk RNASeq steps

Bulk RNASeq Analysis

Main steps of bulk RNASeq

  1. Do a controlled experiment and prepare RNA for sequencing
  2. Sequence the cDNA and produce fastq files
  3. Process the sequence files (fastqs) into a counts matrix
  4. Statistically analyze the counts matrix
Details of the RNASeq study files we use in this tutorial:

Tutorial Expt. Design

The dataset we will use for this live tutorial are from a mouse RNASeq experiment.

Part 2: Using and Accessing the Command Line on MSI

Accessing MSI systems requires that you either be connecting through the UMN network (eduroam or Ethernet in a UMN building) or connected to the UMN VPN. Please see https://it.umn.edu/services-technologies/virtual-private-network-vpn for information on connecting to the UMN VPN.

You will also be required to have DUO multi-factor authentication set up. Please see https://it.umn.edu/services-technologies/self-help-guides/duo-set-use-duo-security for information about enrolling your device in DUO.

Other ways to access a command line on MSI systems:

For PuTTY users, the process for connecting to MSI servers is somewhat different than for the other methods. Please follow the instructions in the MSI PuTTY guide (https://www.msi.umn.edu/support/faq/how-do-i-configure-putty-connect-msi-unix-systems) to connect.

For the Mac OS and Linux methods, type ssh YOUR_ID_HERE@agate.msi.umn.edu then press Enter. Enter your password if you are asked for it. Note that you will not be able to see any text entry as you type your password; this is normal. After you finish entering your password, press Enter again. You will be prompted to authenticate the login attempt with DUO.

Understanding directory and file tree structure:

Directories

In the tree cartoon above, boxes represent directories or files, and indentation represents nesting. The text inside the boxes represents the names. The red box (around /) represents the root of the filesystem, and the blue box (around /Users/tomkono/data.txt) represents a file. The boxes in black are directories.

Notice the slashes (/) between parts of the names - these delimit the actual directories that make up the full path to the file. In the case of /Users/tomkono/data.txt, you can read the name and know that the file called data.txt is located under the root (/), then the Users directory, then the tomkono directory. In UNIX terminology, this is known as the path to the file. More specifically, it is known as the absolute path because it starts at the root of the filesystem. This is the way I prefer to specify paths to files because there is no ambiguity as to where the file is located.

Return to top

2.1: Basic Commands

We will introduce basic commands briefly, then use them to examine the tutorial’s fastq files.

2.1.1: The Structure of a Command

chaco001@ahl02 [/scratch.global/chaco001] % head -n 100 SRR9327252_1.fastq

A UNIX or Linux command consists of a program, options, and arguments.

2.1.3:Basic Commands

# general basic commands
cd <dest>    change directory to destination
cd ..   go up one directory
cd ~/   go to your home directory
ls    list files 
pwd   print working directory
mkdir create a directory
cp <src> <dest>   copy file from src to dest
head <file>    see top lines in file
tail <file>    see bottom lines in file
nano    open file in a text-based file editor 
echo <variable>  print the variable in the terminal
zcat <file.gz>  de-compress a gz file
grep <file> <pattern> search for <pattern> within <file>
man <command> get the manual for <command> (alternatively: command --help)
| the pipe operator, puts the results from the command on the left into the command on the right
wc <file> count the number of lines and characters in a file

# MSI-specific commands (mostly from SLURM)
$USER a variable which holds your user ID
echo $USER  show your username
squeue -u $USER show your pending and running jobs
userquota -u $USER  show your current storage quota and usage
module avail <software> see what version of <software> are available
module load <software> load the <software> 

2.2: Accessing a Command Line on MSI using Open OnDemand

The following link is to a text file containing all commands run on the command line during this tutorial:

rnaseq_cmd_workshop_commands.txt

Open a web browser and navigate to https://ood.msi.umn.edu/. Log in with your UMN user name and password. You will see a screen like the one shown below:

Open OnDemand landing page

Click on the Clusters button. A drop-down menu will fold out. Click on Agate Shell Access:

Open OnDemand shell access

A new tab will open with a command line prompt.

Open OnDemand command line

The portion of the prompt to the left of and including the percent symbol (%) is called the “prompt.” The block is called the “cursor.” When you type commands into the command line, the symbols will appear to the left of the cursor:

Command prompt and cursor

Note that my prompt may look different from yours! The function is identical, regardless of appearance.

Note that you cannot use the mouse to move the cursor around in the terminal area! You must use the arrow keys to move the cursor to edit the command you are currently typing.

Return to top

Return to top

2.2.1: Examine fastq files on the command line

We will use the above commands to examine input files and later run CHURP.

First we change directories to where the tutorial files are located.

chaco001@ahl02 [/scratch.global/chaco001] % cd /common/tutorials/bioinformatics/bulk_rnaseq/Reads/

Print the working directory to ensure we are where we expect.

chaco001@ahl02 [/common/tutorials/bioinformatics/bulk_rnaseq/Reads/] % pwd
/common/tutorials/bioinformatics/bulk_rnaseq/Reads/

Next we examine the contents of this directory.

chaco001@ahl02 [/common/tutorials/bioinformatics/bulk_rnaseq/Reads/] % ls 

Output of ls in tutorials fq dir

Notes:

Examine a fastq file. This requires decompressing (zcat), then piping (|) the results to head (head), so we only look at the top 8 lines (-n 8).

chaco001@ahl02 [/common/tutorials/bioinformatics/bulk_rnaseq/Reads/] % zcat BoneMarrow-1_S23_R1_001.fastq.gz | head -n 8
@SRR7989587:1:TAGCTT:300/1
AGGTGCTCGGCTTCCATTACTGTAGTAGCTGCTGTTCACTGCTCCTTGGCTACCTATGAAATGTTTGATTGAAAATCACT
+SRR7989587.1 1 length=150
AAAAFJAFJFF<FJJAFAJJJJJFJJJFJJJJ<JJFJJJJJJ-FJJJJJJF<77AAFF-FFJFJJJJJJJJFJJFJJJJJ
@SRR7989587:2:TAGCTT:300/1
ATTTTACCAACTGTGTTTTTGTTTTGTTTTGTTTTTTAAGCCACTGCTCAAGTTAATGTCACTGACAGATGGTAAGTTCG
+SRR7989587.2 2 length=150
AA<AFJJJAJJFFAFFJ<FJF-AAJJJFJJJJ<AFJJJJJJFJJJJJFJJJJJFJJJJAJJFJJJJJJJFJJJJF-FFJJ

Notes:

Examine that fastq’s partner file (note the “2” in the file name).

chaco001@ahl02 [/common/tutorials/bioinformatics/bulk_rnaseq/Reads/] % zcat \
BoneMarrow-1_S23_R2_001.fastq.gz | head -n 8
@SRR7989587:1:TAGCTT:300/2
GGCAAACAAGTCCAGTTACGGGGGCCCAGCCAGCCAGCAACTGAGAGGGGGTTACGGAAGAGGTTACGGTGGCAAGAGCA
+SRR7989587.1 1 length=150
AAAFFJJ7JJF-<F7--F<-----7F-F--AF--7FF7---7<A<-<F-A7--A-7FA-F-<-77--<AFFA77-77--A
@SRR7989587:2:TAGCTT:300/2
AGCATCCAGCGTTCCAGGAGCCTGGAGAAACCACCACGTATGCACGGGTGGAATCTGAGTTGGACACAAGTGCACTTAAC
+SRR7989587.2 2 length=150
AAAFFJJFJJJJJFJJFJFJ-FFJFJFJJJJJJJJJJFFJJJFJJJJJFJF-AJJAFFFJFJ-7A-FJJAJAJJ<7AAJJ

Do a gut-check: do both fastq files have the same number of reads (=lines)? They should. Pipe the decompressed file into wc with the option (-l) to count the number of lines.

chaco001@ahl02 [/common/tutorials/bioinformatics/bulk_rnaseq/Reads/] % zcat BoneMarrow-1_S23_R1_001.fastq.gz | wc -l
4026016
chaco001@ahl02 [/common/tutorials/bioinformatics/bulk_rnaseq/Reads/] % zcat BoneMarrow-1_S23_R2_001.fastq.gz | wc -l
4026016

3: CHURP Basics

3.1: CHURP sequence analysis overview

At this point we know where the fastq files are (/common/tutorials/bioinformatics/bulk_rnaseq/Reads/) and how to navigate on MSI, so we are ready to load CHURP. First I will briefly explain what CHURP does:

CHURP processing

Briefly, the SEQUENCE ANALYSIS steps of the workflow are as follows:

Per-sample:

  1. Summarize read quality (fastqc).

  2. Clean reads for low-quality bases and adapter contaminants (trimmomatic).

  3. Map reads to genome to generate a BAM file (hisat2).

  4. Manipulate mapped BAM to right format (samtools)

(additionally, contamination and complexity are analyzed with bbduk and rnaseqc)

Across all samples:

  1. Count reads within genes (featureCounts).

  2. Statistical analysis (more details next) (R, especially edgeR).

  3. Make report (R).

3.2: CHURP statistical analysis overview

CHURP stats

3.3: Accessing and Running CHURP

3.3.1: Using the module system to load CHURP

MSI maintains software for users which can be loaded via module load

Software List: https://msi.umn.edu/our-resources/msi-software

We will access CHURP using module load. We will start from a new directory we make in MSI’s global scratch, which is a special part of the MSI filesystem where you can write temporary data that lasts for one month.

You cannot use my scratch folder (/scratch.global/chaco001) because you do not have permission to access it. To try to prevent confusion, we will therefore use the $USER variable whenever I would typically write chaco001 so that your information is used instead of mine.

The / at the beginning of the file path is important. If you omit it, the computer will interpret the file path as relative to the current path.

First we check that $USER is working as expected by echoing it, then we move to our /scratch.global/ folder

chaco001@ahl02 [/common/tutorials/bioinformatics/bulk_rnaseq/Reads/] % echo $USER
chaco001
chaco001@ahl02 [/common/tutorials/bioinformatics/bulk_rnaseq/Reads/] % cd /scratch.global/$USER
chaco001@ahl02 [/scratch.global/chaco001] % 

Notes:

  1. See that my username was returned when echo $USER was run.
  2. See that I moved into my scratch directory.

If you do not yet have a /scratch.global/$USER folder, then you will need to make it with the following code.

Afterwards, you can use cd /scratch.global/$USER to move to the new directory.

chaco001@ahl02 [/common/tutorials/bioinformatics/bulk_rnaseq/Reads/] % mkdir /scratch.global/$USER
**Learn to copy a file here:**

There is no need to copy files in this tutorial but since it is a common command we show the usage here.

Next, we will copy a file into our current directory. We use the cp command to do this. cp takes two arguments, a source and a destination. For this exercise, the source will be a long path name:

/projects/standard/riss/public/Pathway_Analysis_Tutorial/Test_Data/Drosophila_melanogaster_edgeR_DEG_table_full.txt

and the destination will be the current working directory. This is shorthanded by a dot (.) in the command:

chaco001@ahl02 [/scratch.global/chaco001] % cp /projects/standard/riss/public/Pathway_Analysis_Tutorial/Test_Data/Drosophila_melanogaster_edgeR_DEG_table_full.txt .

Once you have done that, you should see the file if you do ls.

Important: long commands can be broken up using backslashes to make it easier to read. We will show CHURP commands like this shortly:

this_is_a_really_long_command_line \
    with_many_options \
    and_with_many_long_arguments \
    such_that_wrapping_makes \
    it_easier_to_read

See what version of churp are available with module avail:

chaco001@ahl02 [/scratch.global/chaco001] % module avail churp
-------------------------------------------- 
/common/software/modulefiles/migrated/common 
--------------------------------------------
churp/0.2.2-slurm  churp/0.2.3  churp/0.2.4  churp/0.2.5  churp/1.0.0  churp/1.1.0  

Load churp with module load:

chaco001@ahl02 [/scratch.global/chaco001] % module load churp/1.1.0
Latest changes: 2024-07-23
- Filtering routines updated, see
https://github.umn.edu/MSI-RIS/CHURP/blob/main/CHANGES.md#modified for details
- '.in_progress' marker files for jobs submitted but not yet completed to 
prevent multiple submissions
- 'subread_counts.trimmed.txt' now uses tabs instead of spaces in its header
This is CHURP version 1.1.0.
CHURP can be called by running $CHURP.
chaco001@ahl02 [/scratch.global/chaco001] % 

3.3.2: Try running $CHURP and learn required inputs

See what happens when we run $CHURP:

chaco001@ahl02 [/scratch.global/chaco001] % $CHURP
Usage: churp.py <subcommand> <options>
where <subcommand> is the name of the pipeline that is to be run. The specified
<options> will be applied to the operations in the pipeline. Each pipeline has
its own set of options that must be specified. To see a full listing of each
available option for a given pipeline, pass the '--help' option. Alternately,
online help is maintained at the GitHub repository.
Currently, the following subcommands are supported:
    - group_template
    - bulk_rnaseq
For issues, contact help@msi.umn.edu.
Version: 1.1.0
2024-07-23
chaco001@ahl02 [/scratch.global/chaco001] % 

See the help for churp’s bulk_rnaseq subcommand:

Note: some output is hard to show using copy/paste so some output is linked images. Furthermore, I have omitted the optional arguments from this for the moment.

chaco001@ahl02 [/scratch.global/chaco001] % $CHURP bulk_rnaseq --help

CHURP bulk_rnaseq help

Notes:

  1. three required inputs (fq-folder, hisat2-index, gtf)

  2. MANY optional arguments (non-standard adapters, downstream filtering, etc.)

CHURP command we are building (must replace ??? with inputs):

$CHURP bulk_rnaseq \
  --fq-folder ??? \
  --hisat2-index ??? \
  --gtf ??? 

Question: which of these do we already know?

$CHURP bulk_rnaseq \
  --fq-folder /common/tutorials/bioinformatics/bulk_rnaseq/Reads/ \
  --hisat2-index ??? \
  --gtf ??? 

Other Required Inputs:

  1. hisat2-index: pre-made index for the genome hisat2 uses for mapping. Specifically, the basename (directory + file prefix)

  2. gtf: “Gene Transfer Format” file for the genome stating gene feature locations. Specifically, a file ending in .gtf

3.3.3: MSI’s bioref database

MSI provides all up-to-date ensembl main indices, gtfs, and other info in /common/bioref/ensembl

The latest information can be found at https://msi.umn.edu/bioref

The main ensembl databases can be found at https://useast.ensembl.org/index.html

Within /common/bioref/ensembl, organisms are split up by taxon / popularity

Recall, our tutorial dataset is analyzing RNA from the house mouse (Mus musculus) which is a model organism.

Navigate to this organism’s databases on MSI and find the paths of the hisat2 index and gtf:

chaco001@ahl02 [/scratch.global/chaco001] % cd /common/bioref/ensembl/main/Mus_musculus-113/GRCm39/
chaco001@ahl02 [/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/] % ls
annotation  blast  bowtie  bowtie2  bwa  hisat2  logs  seq

Note the multiple databases. seq holds the genome, hisat2 holds the index, and annotation holds the gtf. Examine the sequence fasta:

chaco001@ahl02 [/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/] % cd seq
chaco001@ahl02 [/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/seq] % ls
FASTA.DONE            FASTA_FILE_WGET_LOG     Mus_musculus.GRCm39.dna.toplevel.fa
SAMTOOLS.DONE  genome.fa    FASTA_CKSUM_WGET_LOG
FASTA_REMOTE_CHECKSUMS    Mus_musculus.GRCm39.dna.toplevel.fa.gz  chromlen.len
genome.fa.fai

The genome.fa shows the bases for each chromosome. But it doesn’t show where genes are!

chaco001@ahl02 [/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/seq] % head -n 2 genome.fa
>1 dna:chromosome chromosome:GRCm39:1:1:195154279:1 REF
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Navigate to the hisat2 directory and examine the contents. The basename is the full directory path, plus the filename part before the #.ht2

# input
chaco001@ahl02 [/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/seq] % cd ..
chaco001@ahl02 [/common/bioref/ensembl/main/Mus_musculus-113/GRCm39] % cd hisat2
chaco001@ahl02 [/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/hisat2] % ls
HISAT2.DONE  genome.1.ht2  genome.2.ht2
genome.3.ht2  genome.4.ht2  genome.5.ht2
genome.6.ht2  genome.7.ht2  genome.8.ht2

Now we know that our hisat2-index is: /common/bioref/ensembl/main/Mus_musculus-113/GRCm39/hisat2/genome and therefore our CHURP command is so far:

$CHURP bulk_rnaseq \
  --fq-folder /common/tutorials/bioinformatics/bulk_rnaseq/Reads/ \
  --hisat2-index /common/bioref/ensembl/main/Mus_musculus-113/GRCm39/hisat2/genome \
  --gtf ??? 
**Some extra info on hisat2-index**

This hisat2-index is reference genome that has been indexed for use with HISAT2. For this tutorial, we will be using a genome index that was prepared specially for the tutorial dataset. For an analysis of a real dataset, you will need to use an index prepared from a full genome assembly. A collection of pre-made indices for MSI users (“bioref,” see Part 3.4) and instructions for making your own indices will not be covered directly as part of this tutorial, but will be described in Supplement 1.

Navigate to the annotation directory and examine the contents. The gtf is the one ending in .gtf.

chaco001@ahl02 [/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/hisat2] % cd ..
chaco001@ahl02 [/common/bioref/ensembl/main/Mus_musculus-113/GRCm39] % cd annotation
chaco001@ahl02 [/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/annotation] % ls
GFF.DONE            GFF_REMOTE_CHECKSUMS  GTF_FILE_WGET_LOG
Mus_musculus.GRCm39.113.gff3.gz   GFF_CKSUM_WGET_LOG  GTF.DONE
GTF_REMOTE_CHECKSUMS          Mus_musculus.GRCm39.113.gtf   GFF_FILE_WGET_LOG
GTF_CKSUM_WGET_LOG    Mus_musculus.GRCm39.113.gff3    Mus_musculus.GRCm39.113.gtf.gz

Now we know that our gtf is: /common/bioref/ensembl/main/Mus_musculus-113/GRCm39/annotation/Mus_musculus.GRCm39.113.gtf

Look at the head (top lines) of the gtf file to see that it contains gene feature position information.

chaco001@ahl02 [/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/annotation] % head Mus_musculus.GRCm39.113.gtf
#!genome-build GRCm39
#!genome-version GRCm39
#!genome-date 2020-06
#!genome-build-accession GCA_000001635.9
#!genebuild-last-updated 2023-04
1       havana  gene    108344807       108347562       .       +       .       gene_id "ENSMUSG00000104478"; ...
1       havana  transcript      108344807       108347562       .       +       .       gene_id "ENSMUSG00000104478"; ...
1       havana  exon    108344807       108347562       .       +       .       gene_id "ENSMUSG00000104478"; ...
1       havana  gene    6980784 6981446 .       +       .       gene_id "ENSMUSG00000104385"; ...
1       havana  transcript      6980784 6981446 .       +       .       gene_id "ENSMUSG00000104385"; ...

I removed most of the attribute column for readability.

CHURP command with all genome information:

$CHURP bulk_rnaseq \
  --fq-folder /common/tutorials/bioinformatics/bulk_rnaseq/Reads/ \
  --hisat2-index "/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/hisat2/genome" \
  --gtf "/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/annotation/Mus_musculus.GRCm39.113.gtf"
**Some extra info on GTF annotations**

CHURP also requires a GTF-formatted file with the gene models annotated on the reference genome. This GTF must match the reference genome that is being used for the HISAT2 index; if the chromosome names or coordinates do not match, then expression levels cannot be accurately estimated. The file can be either gzip-compressed or uncompressed, but like with the FASTQ files, we recommend compression to save disk space.

For this tutorial, we will be using a GTF annotation file that was specially-prepared for use with the HISAT2 index. For an analysis of a real dataset, you will need to use a GTF that comes with a reference genome assembly. bioref contains GTF files that are compatible with the collection of HISAT2 genome indices.

Notice the –organism “required” option in $CHURP:

CHURP bulk_rnaseq help

CHURP (as of version 0.2.4) includes a genome_aliases subcommand that will print a table of common genomics models that we maintain in bioref. You can use these shorthands to automatically specify a reference genome and annotation for use with CHURP. The table is below:

chaco001@ahl02 [/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/annotation] % $CHURP genome_aliases
Genome Aliases

The species listed in the table below are common genomics models for which we
have provided convenient shortcuts in CHURP. Use the value in the "Alias" column
to automatically set the relevant genome indices and annotation files in other
CHURP pipelines. These names are *case sensitive.* To read more about MSI's
collection of genomics reference data, including the update schedule, please
see the following page:

https://www.msi.umn.edu/content/bioref

The species listed in the table below are common genomics models for which we
have provided convenient shortcuts in CHURP. Use the value in the "Alias" column
to automatically set the relevant genome indices and annotation files in other
CHURP pipelines. These names are *case sensitive.* To read more about MSI's
collection of genomics reference data, including the update schedule, please
see the following page:

https://www.msi.umn.edu/content/bioref

|         Alias | Binomial Name              | Assembly/Annotation             |
|---------------|----------------------------|---------------------------------|
|   arabidopsis | Arabidopsis thaliana       | TAIR10                          |
|        barley | Hordeum vulgare            | MorexV3_pseudomolecules_assembly|
|       chicken | Gallus gallus              | bGalGal1.mat.broiler.GRCg7b     |
| chlamydomonas | Chlamydomonas reinhardtii  | Chlamydomonas_reinhardtii_v5.5  |
|          corn | Zea mays                   | Zm-B73-REFERENCE-NAM-5.0        |
|           cow | Bos taurus                 | ARS-UCD1.2                      |
|           dog | Canis lupus familiaris     | ROS_Cfam_1.0                    |
|           fly | Drosophila melanogaster    | BDGP6.46                        |
|         human | Homo sapiens               | GRCh38.p14                      |
|         mouse | Mus musculus               | GRCm39                          |
|           pig | Sus scrofa                 | Sscrofa11.1                     |
|           rat | Rattus norvegicus          | mRatBN7.2                       |
|    slime_mold | Dictyostelium discoideum   | dicty_2.7                       |
|       soybean | Glycine max                | Glycine_max_v2.1                |
|         wheat | Triticum aestivum          | IWGSC                           |
|          worm | Caenorhabditis elegans     | WBcel235                        |
|         yeast | Saccharomyces cerevisiae   | R64-1-1                         |
|     zebrafish | Danio rerio                | GRCz11                          |

These can be used with the --organism option with CHURP instead of specifying the --hisat2-index (path to HISAT2 index) and --gtf (path to GTF annotation) values. For example, these options would be equivalent:

# explicit way
$CHURP bulk_rnaseq \
  --fq-folder /common/tutorials/bioinformatics/bulk_rnaseq/Reads/ \
  --hisat2-index "/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/hisat2/genome" \
  --gtf "/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/annotation/Mus_musculus.GRCm39.113.gtf"
  
# short cut, same outcome as above
$CHURP bulk_rnaseq \
  --fq-folder /common/tutorials/bioinformatics/bulk_rnaseq/Reads/ \
  --organism mouse
**Graphic of the CHURP pipeline with file snapshots:**

Here is the same pipeline graph as before, but with some snapshots of relevant files to help you connect all the pieces together.

Recall that the left-hand-side of the pipeline is applied to each sample, before summarizing across samples into the counts matrix.

CHURP pipe with files

Part 3.4: Optional - Experimental Groups

Part 3.4.0: Make a directory for CHURP output

Go back to your /scratch.global/ directory and create a new directory which will hold your output:

chaco001@ahl02 [/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/annotation] % cd /scratch.global/$USER
chaco001@ahl02 [/scratch.global/chaco001] % mkdir RNAseq_Tutorial 
chaco001@ahl02 [/scratch.global/chaco001] % 

Navigate into that directory:

chaco001@ahl02 [/scratch.global/chaco001] % cd RNAseq_Tutorial 
chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial] % 

Part 3.4.1: Using $CHURP group_template to make a fillable excel spreadsheet

Filled-out tutorial groups excel spreadsheet:
https://github.umn.edu/MSI-RIS/Tutorials/blob/gh-pages/tutorial_rnaseq_groups.xlsx

Or use the pre-filled tutorial spreadsheet at this MSI location:

/common/tutorials/bioinformatics/bulk_rnaseq/tutorial_rnaseq_groups.xlsx

The group_template subcommand has it’s own subcommand bulk_rnaseq, upon which we will call --help:

chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial] % $CHURP group_template bulk_rnaseq --help
usage: churp.py group_template bulk_rnaseq --fq-folder <fastq folder> [--help] [--verbosity <loglevel>] [--output <output file>] [--command-log CMD_LOG]
Required arguments:
  --fq-folder <fastq folder>, -f <fastq folder>
                        Directory that contains the FASTQ files.
Optional arguments:
  --help, -h            Show this help message and exit.
  --verbosity <loglevel>, -v <loglevel>
                        How much logging output to show. Choose one of "debug," 
                        "info," or "warn."
  --output <output file>, -o <output file>
                        Write the XLSX to this file. Defaults to 
                      /scratch.global/chaco001/...bulk_rnaseq.groups.xlsx
  --command-log CMD_LOG
                        Save the command that was run into this file. This file 
                        will be appended to, rather than overwritten, so you can 
                        save multiple CHURP runs into this file.

Notes:

  1. required input: fq_folder (/common/tutorials/bioinformatics/bulk_rnaseq/Reads/)
  2. outputs an xlsx file, by default, in your /scratch.global/$USER folder

Make a group_template file in your new folder:

chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial] % $CHURP group_template bulk_rnaseq \
  --fq-folder /common/tutorials/bioinformatics/bulk_rnaseq/Reads/ \
  --output /scratch.global/$USER/RNAseq_Tutorial/tutorial_rnaseq_groups.xlsx
  
----------
Thank you for using CHURP. This software was developed by the Research
Informatics Solutions (RIS) group at MSI with funding from the University of
Minnesota Informatics Institute (UMII). For help, please contact
help@msi.umn.edu.
https://www.msi.umn.edu/
https://research.umn.edu/units/umii
----------
SUCCESS
Template file: /scratch.global/chaco001/RNAseq_Tutorial/tutorial_rnaseq_groups.xlsx
All sample groups and any additional columns have specified have been filled
with NULL. Please edit the file and write in the correct values for your
dataset. Samples with the same "Group" label will be treated as replicates
in the analysis. Samples with a "Group" value of NULL will not be used in
downstream differential expression analysis. When you have edited the file to
your liking, supply its path to the "bulk_rnaseq" pipeline with the -e
option to enable group testing.
chaco001@ahl02 [/scratch.global/chaco001] % 

We see SUCCESS and the path to the template file.

Part 3.4.2: Edit the group_template xlsx

The easiest way to edit the group template file is to download it, open it in excel (or open office / libre office), save it, then re-upload it.

First navigate to the files tab, specifically /scratch.global/$USER:

ondemand files tab

Find the xlsx, then download it:

ondemand download xlsx

Open the xlsx and edit the “groups” tab:

xlsx first page

Steps:

Optionally edit the “contrasts” tab:

xlsx second page

Steps:

Save the file and upload back in the same directory:

xlsx upload

CHURP command with experimental groups (using the pre-made xlsx in /common/):

$CHURP bulk_rnaseq \
  --fq-folder /common/tutorials/bioinformatics/bulk_rnaseq/Reads/ \
  --hisat2-index "/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/hisat2/genome" \
  --gtf "/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/annotation/Mus_musculus.GRCm39.113.gtf"
  --expr-groups "/common/tutorials/bioinformatics/bulk_rnaseq/tutorial_rnaseq_groups.xlsx"
Some extra details on expression groups

CHURP allows you to specify additional metadata columns with the -e option. This option can be specified multiple times for multiple columns; for example, to add columns for Age and Sex, you can include -e Age -e Sex in the command. This makes it easy to build a metadata CSV that can accommodate a more complicated experimental design. Our automated testing, however, only considers the Group column. For analysis of more complicated experiments, please consult with a statistician or with us at RI Bioinformatics!

Note that if you give a sample a NULL group assignment, then it will not be used for differential gene expression testing. You will still get expression counts and QC metrics, though.

CHURP will perform automated differential gene expression testing with up to four groups maximum. It will also only perform automated differential expression testing if and only if all groups have at least three replicates. If your experiment does not conform to these parameters, then you will have to perform differential expression testing yourself with the expression matrix produced by CHURP.

Return to top

Part 3.5: Submit CHURP and checking job

Part 3.5.1: Submitting CHURP and checking created files

We have defined all required inputs and created a group_template.xlsx which is uploaded to /scratch.global/$USER/RNAseq_Tutorial/tutorial_rnaseq_groups.

It is time to submit CHURP.

Two-step submission: We will submit CHURP in two steps by using the --no-submit option. This lets us examine the sample sheet to ensure it looks correct before actually running CHURP. In theory, one can submit CHURP in one step (by omitting --no-submit) but doing so is less careful.

While we have defined all required arguments to CHURP (fq-folders, gtf, hisat2-index), we will also use a number of optional arguments. Most of these arguments change the job submission settings to reduce the duration of the job, making it likelier to complete during the tutorial. One option is needed to ensure the biology is correctly captured.

CHURP full call with --no-submit`

$CHURP bulk_rnaseq \
  --fq-folder /common/tutorials/bioinformatics/bulk_rnaseq/Reads/ \
  --organism mouse \
  --expr-groups /common/tutorials/bioinformatics/bulk_rnaseq/tutorial_rnaseq_groups.xlsx \
  --output-dir /scratch.global/$USER/RNAseq_Tutorial/Out \
  --working-dir /scratch.global/$USER/RNAseq_Tutorial/Work \
  --strand U \
  --queue msismall \
  --ppn 8 --mem 24000 --walltime 2 \
  --no-submit

The parameters specified here are specific for the tutorial dataset! Do not re-use these for an analysis of a real dataset! In particular, the --ppn 8 and -w 2 parameters are for extremely small datasets, and the --strand U parameter is for a specific type of library preparation.

The default RNAseq library preparation kit used by the UMGC is the Illumina TruSeq Stranded mRNA kit, which uses RF strand specificity. This means R1 maps to the “reverse” strand and R2 maps to the “forward” strand. This is the default strand specificity for CHURP.

For low input or marginal quality RNA, the UMGC may use the SMARTer Stranded RNAseq v2 kit from Takara Bio. This kit also has RF strand specificity, but requires a “headcrop” of 3bp (--headcrop 3 for CHURP).

If you have older data that was from the SMARTer Stranded RNAseq v1 kit, it has FR strand specificity, and also requires --headcrop 3 for CHURP.

Your data release email from UMGC will specify which kit was used to prepare your libraries. If you are analyzing data from other sources, you will have to consult the manual of the kit that was used to prepare your data to know the strand specificity. The libraries used in this tutorial come from the “NEBNext Ultra RNA,” which is not strand-specific, which is why we use --strand U in the tutorial.

Telling CHURP the strand specificity does not affect read mapping; it only affects the way fragments are assigned to genes during the quantification step.

Explanation of the additional arguments:

# Important for our biology: 
--strand #our data are unstranded so we specify U

# Not necessary, but helpful:
--output-dir / --working-dir #where final / in-progress files go
--queue # which MSI partition to send the jobs to
--ppn # processors per node
--mem # memory in megabytes per processor
--walltime # how long in hours the jobs can take

# remember, use this to see all arguments:
$CHURP bulk_rnaseq --help

Run the above --no-submit code to generate input files:

chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial] % $CHURP bulk_rnaseq \
  --fq-folder /common/tutorials/bioinformatics/bulk_rnaseq/Reads/ \
  --organism mouse \
  --expr-groups /common/tutorials/bioinformatics/bulk_rnaseq/tutorial_rnaseq_groups.xlsx \
  --output-dir /scratch.global/$USER/RNAseq_Tutorial/Out \
  --working-dir /scratch.global/$USER/RNAseq_Tutorial/Work \
  --strand U \
  --queue msismall \
  --ppn 8 --mem 24000 --walltime 2 \
  --no-submit
2024-10-30 08:59:11,720 - CHURPipelines.Pipelines.Pipeline - WARNING: Output dir /scratch.global/chaco001/RNAseq_Tutorial/
Out is not empty! Results may be clobbered.
2024-10-30 08:59:11,721 - CHURPipelines.Pipelines.Pipeline - WARNING: Working dir /scratch.global/chaco001/RNAseq_Tutorial
/Work is not empty!
----------
Thank you for using CHURP. This software was developed by the Research
Informatics Solutions (RIS) group at MSI with funding from the University of
Minnesota Informatics Institute (UMII). For help, please contact
help@msi.umn.edu.
https://www.msi.umn.edu/
https://research.umn.edu/units/umii
----------
SUCCESS
Samplesheet and pipeline script generation complete! Their paths are given
below:
Pipeline script: /scratch.global/chaco001/RNAseq_Tutorial/Out/2024-10-30.chaco001.bulk_rnaseq.pipeline.sh
Samplesheet: /scratch.global/chaco001/RNAseq_Tutorial/Out/2024-10-30.chaco001.bulk_rnaseq.samplesheet.txt
Sbatch array key: /scratch.global/chaco001/RNAseq_Tutorial/Out/2024-10-30.chaco001.bulk_rnaseq.qsub_array.txt
Verify the information in the samplesheet, and run the pipeline script with
bash while logged into Mesabi. You will recieve email notifications of job
start/completion/error at your UMN X500 email address. If you need to submit
an error report, please contact help[at]msi.umn.edu. Please include the
samplesheet, pipeline script, and the error message with your report.
chaco001@ahl03 [/scratch.global/chaco001/RNAseq_Tutorial/Out] % 

Explanation of output:

Warnings appear because I’d previously run this tutorial, you likely have warnings appear stating that output directories were created.

The important pieces of information are the three paths to files created.

Notice that the message tells you to verify the information in the samplesheet, then run the pipeline script with bash. There is also an outdated reference to Mesabi (a previous version of our supercomputer) which should be ignored.

We will check the sample sheet because that will help us ensure that the groups have been set and that the correct sample name goes with the right fastqs.

Navigate to the Out directory and list the files:

chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial] % cd Out
chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial/Out] % ls
2024-10-25.chaco001.bulk_rnaseq.pipeline.sh     
2024-10-25.chaco001.bulk_rnaseq.samplesheet.txt  2024-10-25.chaco001.bulk_rnaseq.qsub_array.txt

We see the files we expected to see. What are these files?

Check the sample sheet. We will again use the head command to do this:

The following command MUST be changed to match the sample sheet in your directory, because both the date and the username will be different.

chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial/Out] % head -n 2 2024-10-25.chaco001.bulk_rnaseq.samplesheet.txt
BoneMarrow-1|bone|/common/tutorials/bioinformatics/bulk_rnaseq/Reads//BoneMarrow-1_S23_R1_001.fastq.gz|/common/tutorials/b
ioinformatics/bulk_rnaseq/Reads//BoneMarrow-1_S23_R2_001.fastq.gz|/scratch.global/chaco001/RNAseq_Tutorial/Out
|/scratch.global/chaco001/RNAseq_Tutorial/Work|yes|no|ILLUMINACLIP:/home/msistaff/public/CHURP_Deps/v1/db/all_illumina_ada
pters.fa:4:15:7:2:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:18|/common/bioref/ensembl/main/Mus_musculus-113/GRCm
39/hisat2/genome|-p 8 --no-mixed --new-summary |0|/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/annotation/Mus_muscu
lus.GRCm39.113.gtf
BoneMarrow-2|bone|/common/tutorials/bioinformatics/bulk_rnaseq/Reads//BoneMarrow-2_S21_R1_001.fastq.gz|/common/tutorials/b
ioinformatics/bulk_rnaseq/Reads//BoneMarrow-2_S21_R2_001.fastq.gz|/scratch.global/chaco001/RNAseq_Tutorial/Out
|/scratch.global/chaco001/RNAseq_Tutorial/Work|yes|no|ILLUMINACLIP:/home/msistaff/public/CHURP_Deps/v1/db/all_illumina_ada
pters.fa:4:15:7:2:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:18|/common/bioref/ensembl/main/Mus_musculus-113/GRCm
39/hisat2/genome|-p 8 --no-mixed --new-summary |0|/common/bioref/ensembl/main/Mus_musculus-113/GRCm39/annotation/Mus_muscu
lus.GRCm39.113.gtf
Notice the important information, which is separated by “ ”
  1. each row is a sample.

  2. The samples should have the correct group and the right fastqs

  3. all samples should have the same genome / annotation files, which should be correct

  4. There is also information on the trimmomatic settings (ILLUMINACLIP:/home/msistaff/public/CHURP_Deps/v1/db/all_illumina_ada pters.fa:4:15:7:2:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:18)

Also check that the right number of samples are set to be processed using wc:

chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial/Out] % wc -l 2024-10-25.chaco001.bulk_rnaseq.samplesheet.txt
8

If everything seems correct, submit the jobs to be processed on the supercomputer.

This is done by running bash on the file ending in pipeline.sh:

chaco001@ahl03 [/scratch.global/chaco001/RNAseq_Tutorial/Out] % bash 2024-10-30.chaco001.bulk_rnaseq.pipeline.sh 
sbatch: Setting account: riss
sbatch: Setting account: riss
You are running CHURP version 1.1.0
Output and logs will be written to /scratch.global/chaco001/RNAseq_Tutorial/Out
Emails will be sent to chaco001@umn.edu
Sbatch array to samplename key: /scratch.global/chaco001/RNAseq_Tutorial/Out/2024-10-30.chaco001.bulk_rnaseq.qsub_array.txt
Single samples job array ID: 25488518
Summary job ID: 25488519
chaco001@ahl03 [/scratch.global/chaco001/RNAseq_Tutorial/Out] %

Important information in output:

Part 3.5.2: Checking the job status in the queue

Once CHURP has been submitted, we can check the jobs’ statuses in the queue.

Note that CHURP makes as many jobs as there are samples, plus one. This is because each sample is processed into a BAM file in its own job, then the counts matrix and report is made in a separate job.

Use squeue to check job status. Your job numbers and user will differ:

chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial] % squeue -u $USER
             JOBID PARTITION     NAME     USER ST       TIME  NODES NODELIST(REASON)
          25488519   msismall run_summ chaco001 PD       0:00      1 (Dependency)
    25488518_[1-8]   msismall bulk_rna chaco001 PD       0:00      1 (None)
chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial] % 

Notes:

Here, I captured the job status before they began running.

Part 4: CHURP output

If your jobs have finished successfully you should have received emails giving that status. Specifically, the job with a name similar to run_summary_stats.sh must have completed with SUCCESS for all results to be observed.

Examine the files and directories created by CHURP:

chaco001@ahl03 [/scratch.global/chaco001/RNAseq_Tutorial/Out] % ls
2024-10-25.chaco001.bulk_rnaseq.pipeline.sh
2024-10-25.chaco001.bulk_rnaseq.qsub_array.txt
2024-10-25.chaco001.bulk_rnaseq.samplesheet.txt
Bulk_RNAseq_Report.html
Coordinate_Sorted_BAMs
Counts
Counts.zip
DEGs
InsertSizeMetrics
Logs
Mus_musculus.GRCm39.113.gtf
Plots
allsamples_work_directory
bulk_rnaseq_single_sample-25492402.1.err
bulk_rnaseq_single_sample-25492402.1.out
bulk_rnaseq_single_sample-25492402.2.err
bulk_rnaseq_single_sample-25492402.2.out
bulk_rnaseq_single_sample-25492402.3.err
bulk_rnaseq_single_sample-25492402.3.out
bulk_rnaseq_single_sample-25492402.4.err
bulk_rnaseq_single_sample-25492402.4.out
bulk_rnaseq_single_sample-25492402.5.err
bulk_rnaseq_single_sample-25492402.5.out
bulk_rnaseq_single_sample-25492402.6.err
bulk_rnaseq_single_sample-25492402.6.out
bulk_rnaseq_single_sample-25492402.7.err
bulk_rnaseq_single_sample-25492402.7.out
bulk_rnaseq_single_sample-25492402.8.err
bulk_rnaseq_single_sample-25492402.8.out
gene_id_gene_name_map.txt
run_summary_stats-25492403.err
run_summary_stats-25492403.out
singlesamples_work_directory

Notes:

  1. .err and .out files for each job

  2. output directories:
    • Counts, DEGs (if comparisons added to group_template), Logs, Plots, Coordinate_Sorted_BAMs, InsertSizeMetrics (if using paired reads)
  3. An html report called Bulk_RNAseq_Report.html

Part 4.1: CHURP BAM files

Most results are easiest to examine using the Open OnDemand browser. The exception are the BAM files. These are the files which show the coordinates to which each read mapped, and many important mapping details. While one doesn’t need to understand them to use CHURP or do differential expression testing, it is good to familiarize oneself with them as they are the basis for many other workflows.

These files cannot be viewed with Open OnDemand because they are compressed, and therefore special software is required. Luckily we have a module for that!

Navigate to the Coordinate_Sorted_BAMs directory and list what files are present:

chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial] % cd Coordinate_Sorted_BAMs
chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial/Coordinate_Sorted_BAMs] % ls
BoneMarrow-1_MAPQFiltered_CoordSort.bam      Spleen-1_MAPQFiltered_CoordSort.bam
BoneMarrow-1_MAPQFiltered_CoordSort.bam.bai  Spleen-1_MAPQFiltered_CoordSort.bam.bai
BoneMarrow-1_Raw_CoordSort.bam               Spleen-1_Raw_CoordSort.bam
BoneMarrow-1_Raw_CoordSort.bam.bai           Spleen-1_Raw_CoordSort.bam.bai
BoneMarrow-2_MAPQFiltered_CoordSort.bam      Spleen-2_MAPQFiltered_CoordSort.bam
BoneMarrow-2_MAPQFiltered_CoordSort.bam.bai  Spleen-2_MAPQFiltered_CoordSort.bam.bai
BoneMarrow-2_Raw_CoordSort.bam               Spleen-2_Raw_CoordSort.bam
BoneMarrow-2_Raw_CoordSort.bam.bai           Spleen-2_Raw_CoordSort.bam.bai
BoneMarrow-3_MAPQFiltered_CoordSort.bam      Spleen-3_MAPQFiltered_CoordSort.bam
BoneMarrow-3_MAPQFiltered_CoordSort.bam.bai  Spleen-3_MAPQFiltered_CoordSort.bam.bai
BoneMarrow-3_Raw_CoordSort.bam               Spleen-3_Raw_CoordSort.bam
BoneMarrow-3_Raw_CoordSort.bam.bai           Spleen-3_Raw_CoordSort.bam.bai
BoneMarrow-4_MAPQFiltered_CoordSort.bam      Spleen-4_MAPQFiltered_CoordSort.bam
BoneMarrow-4_MAPQFiltered_CoordSort.bam.bai  Spleen-4_MAPQFiltered_CoordSort.bam.bai
BoneMarrow-4_Raw_CoordSort.bam               Spleen-4_Raw_CoordSort.bam
BoneMarrow-4_Raw_CoordSort.bam.bai           Spleen-4_Raw_CoordSort.bam.bai

There is a filtered and unfiltered BAM per sample, as well as an index (.bai).

We will use samtools, a common and useful bioinformatics tool, to decompress one BAM file and look at its head.

chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial/Coordinate_Sorted_BAMs] % module load samtools/1.16.1-gcc-8.2.0-egljrr3 
chaco001@ahl02 [/scratch.global/chaco001/RNAseq_Tutorial/Coordinate_Sorted_BAMs] % samtools view BoneMarrow-1_MAPQFiltered_CoordSort.bam | head -3

ead of BAM file

Part 4.2: CHURP output directories

Navigate to the output directory on Open OnDemand to peruse the remaining outputs:

Out directory on Open OnDemand

Part 4.2.1: CHURP most important directories

We will focus here on the most important directories.

Navigate into the Counts directory and observe the outputs:

Counts directory on Open OnDemand

Notes:

  1. These files contain counts matrices that have one gene per row and the samples are columns. They can be loaded into R or other programs for re-analysis.

  2. subread_counts_trimmed.txt is the main file to use for re-analysis as it omits extraneous transcript metadata in subread_counts.txt. The values in the cells are the raw read counts.

  3. featureCounts created subread_counts.txt from which all other files derive

  4. cpm_list.txt contains filtered and normalized counts in “log base 2 counts per-million” values. This should only be used for visualization, not statistical analysis.

  5. subread_counts_gene_symbol.txt is the same as subread_counts_trimmed.txt but with human-readable gene symbols rather than stable gene IDs. This file may be easiest to open and look through in Excel.

Snippet showing loading raw read counts into R

We will not perform any analysis with subread_counts_trimmed.txt directly, least of all with a text file viewer. This is outside of the scope of this tutorial, but if you would like to read these values into R, you can use the following snippet:

subread_cts <- read.table("subread_counts_trimmed.txt", header=TRUE, sep="\t")
raw_read_cts <- as.matrix(subread_cts[,-c(1:6)])
rownames(raw_read_cts) <- subread_cts[, 1]

Note: you will need to specify the path as well in read.table(), or copy the txt file to your working directory.

These can then be used as the expression data for analysis with EdgeR or DESeq2. If you are interested in performing your own differential expression analysis, then you can refer to the guides for EdgeR and DESeq2:

The experimental metadata CSV that you generated will also be helpful for running your own differential expression analyses.

Navigate to the DEGs directory:

DEGs directory on Open OnDemand

Understand DEG file names with respect to reference / test groups

The filename has some interpretative meaning here. You will notice that the filename has a pair of the group names that we assigned in Part 4.2, in this case Spleen and BoneMarrow. These denote the groups that were compared for differential gene expression.

The general form the filename takes is DE_GROUP2-GROUP1_list.txt, and GROUP1 is treated as the reference group and GROUP2 is treated as the test group. Therefore, genes that have positive log(fold change) values are up-regulated in GROUP2 with respect to GROUP1, and genes with negative log(fold change) values are down-regulated in GROUP2 with respect to GROUP1. In this case, BoneMarrow is the reference group, and Spleen is the test group.

These are main outputs if you designated differential expression comparisons to be made. We specified one contrast, so there is one file. Click it:

DEG file on Open OnDemand

The first row has the names of the columns. There are six pieces of information for each gene:

  1. genes: gene name
  2. logFC: log2(fold change) test group - reference group
  3. logCPM: average log2(expression) over all samples in matrix
  4. F: Ftest statistic from quasi-likelihood edgeR analysis
  5. Pvalue: raw p-value for the test statistic
  6. FDR: BH-corrected p-value to adjust for multiple comparisons

Traditionally, “differentially-expressed genes” are those with FDR < 0.05 AND absolute(logFC) > 1, but these thresholds depend on the experiment.

Details on filtering done before testing

The test that is done is the quasi-likelihood F test in EdgeR. You can read more about the quasi-likelihood F test in the EdgeR user manual:
https://bioconductor.org/packages/release/bioc/html/edgeR.html

The expression values are filtered before being used for differential gene expression testing with CHURP. The following filters are applied:

  1. Genes that are shorter than 200bp are removed (this can be adjusted with a command line argument).
  2. Samples with NULL group assignments are removed.
  3. Genes with low expression* are removed.

*: We define “low expression” as follows:

  1. Calculate the median library size.
  2. Calculate C, the CPM (not on the log2 scale) value that would be obtained from a raw count of X fragments in this median library. By default X is 10 fragments, but is adjustable with the --min-count option to CHURP.
  3. Calculate K, the size of the smallest non-NULL group.
  4. Calculate CPM (not log2 scale) for all genes in non-NULL samples.
  5. Keep only genes where at least K samples have an expression level of C or greater, regardless of their group assignment.

This filtering scheme is similar to that implemented by edgeR’s filterByExpr() function. We recreate it manually so that we can fully report the calculated thresholds for sample number and expression level.

We still advocate that differential expression testing be done with human input, rather than with the automated processing. CHURP cannot automatically evaluate diagnostic or summary plots such as dispersion trends, biological coefficients of variation, nor clustering patterns.

Part 4.2.2: CHURP other output directories

These outputs are less critical for most users.

Insert Size Directory

InsertSize directory on Open OnDemand

We see that there are two files for each sample, a hist.pdf file and a metrics.txt file. The hist.pdf file contains a histogram of insert sizes for the sample.

You should check that this distribution matches what was expected based on your molecular protocol QC. Unfortunately, for the tutorial dataset, we do not have access to such information.

The histogram is nice, but to describe the distributions in writing, we will need textual and numerical summaries of the insert sizes. We can find these in the metrics.txt files. This file has very long lines, so you will likely have to use the arrow keys to scroll side-to-side to read the information. We will not cover the meaning of every field in this file, but you can get instructions for how to read this file from the Picard Tools documentation:
https://broadinstitute.github.io/picard/picard-metric-definitions.html#InsertSizeMetrics

Plots Directory

Plots directory on Open OnDemand

  1. These are the unsupervised plots labeled with the group from group_template

  2. They were made during the R analysis and are also described in the report

Logs Directory

Logs directory on Open OnDemand

Notes:

  1. There are two files per sample

  2. Analysis logs can be used to see when CHURP started different sections (lines beginning with #), as well as the output from software CHURP uses.

  3. Trace logs can be useful to see the progression of steps

Scheduler log files (.err, .out)

In the Out directory, a .err and .out file were made per job.

Notes:

  1. If an error occurred, it should be logged in the .err file.

  2. The sample name for the single-sample logs is in the first line.

  3. These files aren’t critical for users to examine, but can be interested for
    bookkeeping. Specifically, the .err file shows when each section started and completed.

Part 4.3: CHURP BULK_RNASeq_report.html

This report contains all of the QC metrics and analyses conducted by CHURP and is therefore likely to be the most important document to examine in detail.

To view it, download the Bulk_RNASeq_Report.html file then re-open it (just clicking is insufficient as most browsers will default to showing you the raw html).

You can also download an example here: https://pages.github.umn.edu/MSI-RIS/Tutorials/materials/rnaseq_cmd/Bulk_RNAseq_Report.html

The top of the report should look like this:

bulkrnaseq report headd

Note: The report contains downloadable files for the relative expression information (e.g. raw read counts), pipeline.sh, and samplesheet.txt.

The report itself is thoroughly self-explained. Regardless, here are some guiding questions to consider as you examine it.

  1. Section 1: Data Processed
    • Are the sample names correct?
    • Is the number of samples correct?
    • Are the reference genome and annotation correct?
  2. Section 2.1: Read Counts
    • Do any samples have extreme (high or low) values for fragment count?
    • Do any samples lose a lot of reads after trimming?
  3. Section 2.2: Insert Size Metrics
    • Do any samples have insert size distributions that do not match your expectations from a gel or BioAnalyzer?
  4. Section 2.3: Estimated rRNA Content
    • Do any samples have very high rRNA content? Is it unexpected?
  5. Section 2.4: Basecall Quality
    • Do any samples have very low quality overall?
    • Is there a stretch of low-quality bases in the beginnings of reads?
  6. Section 2.5: QC Based on Mapping to Reference Genome
    • Is the exon profiling efficiency close to 1? Are there samples with very low values for exon profiling efficiency?
    • Are there samples with very low estimated library complexity? It should ideally be close to the number of sequenced fragments.
    • Are there samples with very high sequence duplication levels?
    • Do the reads look like they were sequenced from the expected strand?
  7. Section 3.1: Mapping Statistics
    • Are there samples with very high proportions of MAPQ=0 reads?
    • Are there samples that have very low mapping rates relative to others?
  8. Section 3.2: HISAT2 Summaries
    • Are there samples with very high discordantly mapped or unmapped reads?
  9. Section 3.3: Feature Counts
    • Are there samples with a high proportion of “Unassigned” fragments?
    • Do all samples have roughly the same number of genes detected in the expression data?
  10. Section 4.1: Exploratory Plots*
    • Do all samples have roughly the same distribution of expression values?
    • What are the major groups identified in the clustering heatmap and the MDS plot? Do samples tend to cluster by group, or by some other variable?
  11. Section 4.2: Differential Expression Testing
    • Are the groups correctly specified?
    • Do the most significant DEGs make sense given your experimental design?

*: Please note that it does not necessarily indicate a failure or a quality problem if your samples do not cluster by experimental group! In fact, one of the assumptions underlying bulk RNAseq for differential gene expression analysis is that only a small number of genes (relative to all genes assayed) are truly differentially expressed across groups. The clustering plots show patterns of genome-wide gene expression, so it is not necessarily expected that experimental group is the primary axis of variation.

Part 5: Next Steps and feedback contact information

There are many other downstream analyses which can be down. This graphic summarizes some analyses and with which outputs they begin.

bulkrnaseq downstream options

FEEDBACK CONTACT

This tutorial document was prepared by Jeremy Chacón and Thomas Kono, in the RI Bioinformatics group at MSI.Please send feedback, comments, and CHURP usage questions to ribhelp [at] msi.umn.edu.

Thank you for reading this document, we hope it helps your research! What follow are a number of supplementary sections that help explain some important CHURP options as well as describe some other analyses that can be done with this sort of data. Best of luck with your research!

Supplementary Information

The information in the following sections is not part of the primary tutorial. We provide it only to discuss and illustrate issues and operations that are relevant to RNAseq analysis, but only come up in special circumstances.

Supplement 1: Custom HISAT2 Indices

In the cases where your study organism does not have a reference genome in the sections of Ensembl that we include in bioref, you will need to prepare your own index files for read mapping. You may also want to prepare a custom index if you want to restrict the genome to a specific set of regions (like we did for the tutorial), or if you have an experiment that involves a transgenic organism with a known construct transformed into it, and you want to map reads to the genome as well as the construct.

To do this, you will need at minimum the FASTA file that contains the genome sequence for your study organism. If you have the GTF annotation file, this can aid in preparing the HISAT2 index, as well. Known single nucleotide polymorphism sites (from dbSNP or VCF) can also be used.

You can find a full list of options for HISAT2 index building in their manual:
http://daehwankimlab.github.io/hisat2/manual/#the-hisat2-build-indexer

To build the index, you must be logged in to an interactive compute session:

srun -N 1 -n 1 -c 1 -t 60 --mem=4gb --tmp=2gb -p interactive --pty bash

Make sure the genome file is unzipped; the HISAT2 index builder does not take compressed FASTA input. Place this file into a directory where you would like to store the HISAT2 index files. Do the same with the GTF annotations, if you have them:

mkdir -p /home/GROUP/shared/HISAT2_Genomes/Genus_species
cp /path/to/genome.fasta.gz /home/GROUP/shared/HISAT2_Genomes/Genus_species
cp /path/to/annotations.gtf.gz /home/GROUP/shared/HISAT2_Genomes/Genus_species
gzip -d /home/GROUP/shared/HISAT2_Genomes/Genus_species/genome.fasta.gz
gzip -d /home/GROUP/shared/HISAT2_Genomes/Genus_species/annotations.gtf.gz

where GROUP is your MSI group name.

If you do not have a GTF annotation file, and instead only have a GFF annotation file, you can convert the GFF to a GTF using the gffread utility from the cufflinks package. This is a common scenario with reference genome assemblies from NCBI:

module load cufflinks/2.2.1
gffread annotations.gff3 -T -o annotations.gtf

Load the HISAT2 module and navigate to the genome directory:

module load hisat2/2.1.0
cd /home/GROUP/shared/HISAT2_Genomes/Genus_species

If you want to use known splice sites to help with spliced alignment, use the extract_splice_sites.py script that is bundled with HISAT2 to extract the splice sites from the GTF:

extract_splice_sites.py annotations.gtf > splice_sites.txt

If you would like to use known polymorphic sites to help map reads across known polymorphisms in your study organism, you must have either a dbSNP database export (for humans), or a VCF with known polymorphisms. If you have a dbSNP export, make sure the chromosome names match the genome you are using (UCSC, Ensembl, and NCBI all have different naming conventions), then use the hisat2_extract_snps_haplotypes_UCSC.py script to extract them:

hisat2_extract_snps_haplotypes_UCSC.py genome.fasta dbSNP.txt hisat2_snps

If you have a VCF, you can use the hisat2_extract_snps_haplotypes_VCF.py script to do the same thing:

hisat2_extract_snps_haplotypes_VCF.py genome.fasta SNPs.vcf hisat2_snps

Then, you are ready to build the genome index. This step should be done as a non-interactive batch job. It requires a lot of time and memory. For example, to build the human genome index with known splice sites and known polymorphisms, it takes at least several hours and about 200GB of RAM. The script would look something like the following. Remove the option for --ss if you do not have known splice sites, and remove options for --snp and --haplotype if you do not have known polymorphic sites. Note that you may have to adjust the resource requests if you experience walltime errors or out-of-memory errors, and use your email address instead of YOUR_INTERNET_ID:

#!/bin/bash
#SBATCH -N 1
#SBATCH -n 1
#SBATCH -c 16
#SBATCH --mem=500gb
#SBATCH -t 36:00:00
#SBATCH --mail-type=BEGIN,END,FAIL
#SBATCH --mail-user=YOUR_INTERNET_ID@umn.edu
#SBATCH -p ram1t
#SBATCH -e HISAT2_Build_%j.err
#SBATCH -o HISAT2_Build_%j.out

module load hisat2/2.1.0

cd /home/GROUP/shared/HISAT2_Genomes/Genus_species
hisat2-build -f \
    -p 16 \
    --ss splice_sites.txt \
    --snp hisat2_snps.snp \
    --haplotype hisat2_snps.haplotype \
    genome.fasta \
    hisat2_genome_idx

Submit the job with sbatch and wait for it to finish. There will eventually be eight files that make up the genome index, and they must all be present in the same directory and have the same prefix. The name of your genome index will then be hisat2_genome_idx, and you can use this with the -x option to CHURP’s bulk RNAseq workflow:

...
-x /home/GROUP/shared/HISAT2_Genomes/Genus_species/hisat2_genome_idx
...

You can find a full list of options for HISAT2 index building in their manual:
http://daehwankimlab.github.io/hisat2/manual/#the-hisat2-build-indexer

Return to top

Supplement 2: Customizing CHURP Behavior

We try to provide “sensible defaults” for CHURP’s behavior, but as with any analytical workflow, there exist datasets that require adjustment to the parameters. Most of the time, these cases can be addressed by adjusting the options to the read mapping software or the trimming software. In Supplement 3, we provide instructions for adjusting the expression quantification if you need a different type of expression analysis than the default gene-level expression.

Supplement 2.1: Custom HISAT2 Options

CHURP provides the --hisat2-opts option for adjusting the HISAT2 options. This is required when handling datasets that do not match the “default” dataset that CHURP expects. For example, if your paired-end reads are “interleaved” - R1 and R2 are contained in the same file rather than in separate files. Another case might be if you are analyzing a dataset with different quality score encodings: at the time of this writing, Illumina quality scores are “PHRED+33” but older datasets are “PHRED+64.”

Wikipedia has a good description of the various types of quality score encodings that you may encounter in FASTQ format:
https://en.wikipedia.org/wiki/FASTQ_format#Quality

Data that is generated contemporary to this writing will be in “Sanger” scale, with “PHRED+33” encoding.

You may additionally want to change how HISAT2 handles discordant read pairs or read pairs that fail to map to the genome. All of these options are available to adjustment! Please see the HISAT2 manual for the full range of options that you can provide:
http://daehwankimlab.github.io/hisat2/manual/

The default options that we supply for HISAT2 are the following:

To specify custom HISAT2 options, you must pass it as a quoted string. This is because CHURP unfortunately tries to treat the options meant for HISAT2 as its own, and throws errors. For example, the default options defined above would be passed as follows:

...
--hisat2-opts="-p 6 --no-mixed --new-summary"
...

Any adjustment to the HISAT2 options with --hisat2-opts requires that you set all of the HISAT2 options. For example, if you are handling data that has “PHRED+64” quality scores, you would specify --phred64, but you will then also have to specify the multithreading options and pair-handling options:

...
---hisat2-opts="-p 6 --phred64 --no-mixed"
...

We require this because it is impossible for us to verify every possible combination of HISAT2 options. It is also possible that the custom HISAT2 options are incompatible with downstream expression quantification routines. If you encounter errors while providing custom HISAT2 options, you must troubleshoot the errors independently.

Supplement 2.2: Custom Trimmomatic Options

CHURP also provides the --trimmomatic-opts option for adjusting the behavior of Trimmomatic. This would be required when handling data that have non-standard adapter sequences or if your data have a quality score encoding that is not “PHRED+33.”

The default options string that we pass to Trimmomatic is below:

ILLUMINACLIP:4:15:7:2:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:18

Which performs the following steps:

  1. ILLUMINACLIP:4:15:7:2:true: trim the standard Illumina adapters, allowing up to 4 mismatches, a palindrome clip threshold of 15 (when “read-through” into the adapter is detected in short fragments), minimum palindrome adapter length of 7, and keep both reads in the pair if a palindrome is detected.
  2. LEADING:3: trim bases from the start of the read if they have quality scores lower than 3.
  3. TRAILING:3: trim bases from the end of the read if they have quality scores lower than 3.
  4. SLIDINGWINDOW:4:15: divide the read into 4-base wide sliding windows, removing windows where the mean quality score is below 15.
  5. MINLEN:18: remove read if it is shorter than 18bp after the previous trimming steps have been applied.

Like with the custom HISAT2 options, these must be passed as a quoted string. The default options would look like the following:

...
--trimmomatic-opts="ILLUMINACLIP:/path/to/adapters.fa:4:15:7:2:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:18"
...

Additionally, any adjustment to the Trimmomatic options requires that you specify the entire options string. The only exception is adding a HEADCROP operation, which can be done through CHURP by adding the --headcrop option (we provide this for handling the Takara Bio library preparation protocols).

Please see the Trimmomatic homepage to view the manual that gives the full range of options that are supported:
http://www.usadellab.org/cms/?page=trimmomatic

Supplement 3: Transcript-level Analyses

By default, CHURP performs expression quantification at the gene feature level. This is the feature level that is targeted by most bulk RNAseq experiments and the feature level at which expression is most confidently measured. If you would like to instead measure transcript (isoform) feature expression, you will have to take special care with the molecular protocol and sequencing (data collection) as well as the downstream analytical workflow.

We cannot provide nearly complete scripts like we can with Supplement 1 because transcript-level analyses are highly specific to each study. Both the experimental design and the idiosyncrasies of the study system affect how the analysis is carried out. We instead provide points to consider when performing a transcript-level analysis. Of course, if you work in a research system that does not have alternative splicing, then this does not apply!

Supplement 3.1: Data Collection Considerations

Measuring isoform expression requires that you be able to distinguish the transcripts based on their splicing junctions or untranslated sequences. Additionally, detecting isoforms that have low expression requires deeper sequencing than detecting gene-level expression. You may also be interested in conditionally-expressed isoforms (tissue-specific, disease-specific, etc), which requires special experimental designs.

Unfortunately, we cannot provide general recommendations for sequencing depth nor sampling strategies to capture these cases. You should have a good sense of the “dynamics” of the genome of your study species - the distribution of the number of annotated isoforms for each gene model and the circumstances under which they are expressed will help to guide your experiments. The moments of that distribution will also guide you in sequencing depth; for example, if there are 4 isoforms per gene on average, you should expect to collect at least 4 times as much sequence data as for a gene-level experiment. The real number will be higher because not every isoform is expressed at the same level.

For human or mouse RNAseq experiments, this means you will need to collect at least 100 million read pairs (fragments) per sample for isoform level expression studies. If you want to assay the rare isoforms, then you likely will need to collect at least 200 million read pairs per sample. You may be able to use shorter read length to offset the cost of collecting so many reads, but that depends on the nature of the genes in your study system.

Supplement 3.2: Analytical Workflow Considerations

The read QC and trimming portions of the workflow can proceed as they would with CHURP. However, obtaining accurate transcript-level counts requires deviating from the CHURP workflow at the read mapping step. Instead of mapping read pairs to the reference genome with HISAT2, you should use a tool like RSEM (RNASeq by Expectation Maximization; Li and Dewey 2011; https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-12-323) to perform transcript quantification. The reason you need to change the read mapping workflow is that RSEM can estimate the transcript of origin for each fragment, while HISAT2 cannot. Because the multiple transcripts from a gene model are highly overlapping, the mapping-then-counting approach with HISAT2 and featureCounts cannot accurately estimate expression of the isoforms.

Please see the RSEM GitHub page (https://github.com/deweylab/RSEM#readme-for-rsem) for usage information and examples that show how to use it.

If you are confident that the reads from your experimental samples are very similar to the reference genome (less than 0.1% different at the nucleotide level), then you can use tools like Salmon (Patro et al. 2017; https://www.nature.com/articles/nmeth.4197) or Kallisto (Bray et al. 2016; https://www.nature.com/articles/nbt.3519) to estimate transcript abundances from reads. These two methods rely on very high similarity between the reads the reference genome, however, so we do not recommend them for general-purpose RNAseq, where you expect sequence differences between the experimental samples and the reference genome.

See the Salmon documentation (https://salmon.readthedocs.io/en/latest/) and the Kallisto documentation (https://pachterlab.github.io/kallisto/manual) for instructions on how to use their software to estimate transcript abundance.

All of RSEM, Salmon, and Kallisto are available on MSI systems as software modules:

module avail rsem
-------------------------------- /panfs/roc/soft/modulefiles.common --------------------------------
rsem/1.3.0
module avail salmon
--------------------------------- /panfs/roc/soft/modulefiles.hpc ----------------------------------
salmon/0.14.1  salmon/1.2.1
module avail kallisto
-------------------------------- /panfs/roc/soft/modulefiles.common --------------------------------
kallisto/0.43.1  kallisto/0.46.2

Transcript abundance estimates from the above-mentioned tools will not work with the same routines for differential expression testing as gene-level counts data. Gene-level expression is count-based (i.e., the data are integers), while transcript abundances are often reported in “TPM” (transcripts per million) values and “estimated counts” values. You can use the “estimated counts” values in a differential expression workflow built for analyzing counts data, like those in DESeq2 or EdgeR. If you use the TPM values, you can use a program like Sleuth (Pimentel et al. 2017; https://www.nature.com/articles/nmeth.4324; https://github.com/pachterlab/sleuth) to perform differential expression analysis.

Supplement 4: CPM, TPM, FPKM, RPKM, etc

RNAseq expression analyses are sometimes performed with normalized relative expression values rather than with raw fragment counts like we have done in this tutorial. Some analyses like coexpression network analyses, require normalized relative expression values rather than fragment counts.

Differential gene expression analyses should always be done with the raw fragment counts because the software packages that perform these analyses have statistical routines to properly model the distribution of expression values from fragment count data. The R packages discussed in this tutorial(edgeR and DESeq2) additionally perform robust cross-sample normalization, which none of the units described here will incorporate. These expression values should only be used as auxiliary to the results from the actual differential gene expression tests.

These units are also specific to the experiment or sequencing run. They are NOT comparable across experiments because they are very sensitive to the composition of the libraries. To properly analyze data from multiple experiments, you must take a meta-analysis approach; consult with a statistician!

Normalized relative expression values are useful for comparing genes or samples when there are differences in sequencing depth and gene length. For example, if you were to compare the fragment counts of a single gene across multiple samples, then both gene expression variation and sequencing depth variation will contribute to the fragment counts differences. On a related note, if you were to compare the fragment counts of different genes in the same sample (e.g., to check if knock-down of one gene leads to other gene expression responses), then both gene expression response and gene length differences will contribute to counts differences. This is because longer genes and transcripts have a larger “sequencing target” than shorter genes and transcripts. If two genes have the same transcript abundance, then the longer gene will have higher fragment counts simply because there is a higher representation of its transcript in the sequencing library.

One common relative expression value is normalized counts per million(CPM). To calculate CPM, first sum the fragment counts from all genes, and divide the sum by 1,000,000: this is the “per million” scaling factor. Then, for each gene, divide its fragment count by the scaling factor. This value is useful for comparing the same gene across samples because it accounts for sequencing depth variation. It is not useful for comparing different genes within the same sample because it does not account for gene length differences. Specifically with EdgeR, the values are output on the log2 scale, and a “pseudocount” is added to the raw counts value before normalizing by library size to avoid calculating log2(0).

Another common relative expression value is transcripts per kilobase-million (TPM). This value is proportional to transcript relative abundance within a single sequencing library. For each gene or transcript, calculate a “counts per kilobase” value, which is the fragment count divided by the length of the gene/transcript in kilobases (length / 1000). Sum the “counts per kilobase” values across all genes or transcripts and divide by 1,000,000: this is the “per million” scaling factor. Divide each gene or transcript’s “counts per kilobase” value by the scaling factor. One feature of TPM values is that the sum of all per-feature TPM values will be equal across samples (much like describing concentration values in a mixture with ppm). However, it is sensitive to library composition differences among samples, so it should not be used to compare relative expression of a gene between samples.

Really, RPKM and FPKM should just be abandoned. We include them here just because some researchers still use them (and older publications report them).

Older units like reads per kilobase per million (RPKM; single-read data) and fragments per kilobase per million (FPKM; paired-end and single-read data) are very similar in spirit to TPM. The main difference is that TPM normalizes first by the gene or transcript length, then by sequencing depth, while RPKM and FPKM normalize first by sequencing depth then by gene or transcript length. While this difference seems minor, RPKM and FPKM do not have the property that the sum of expression values is the same for each sample. Thus, it is not possible to interpret FPKM or RPKM differences as proportional differences in transcript abundance. It is also worth noting that Cufflinks includes some probabilistic read mapping parameters in its FPKM calculations, so the FPKM values obtained from Cufflinks will be different than if you calculate them via the formula as written.

This was once a topic of much discussion, and you can read a nice summary of various expression values and their merits and weaknesses here:
https://haroldpimentel.wordpress.com/2014/05/08/what-the-fpkm-a-review-rna-seq-expression-units/

Supplement 5: Depositing Data into GEO

After you have finished analyzing your experiment and interpreting the results, you will likely want to publish your findings. Many journals require that your raw reads and processed expression data be made available in public repositories, like NCBI’s Gene Expression Omnibus (GEO). GEO accession numbers may also be required during peer review so it is important to note this section as you are preparing your manuscript. GEO can also place a hold or embargo on your data until publication, so your data can remain private until you decide to release it.

Submitting your raw and processed data to GEO will make it available in both GEO and NCBI’s Sequence Read Archive (SRA).

GEO says it can take up to five (5) business days to issue accession numbers for your dataset. Please plan accordingly!

The lab who is publishing the study should be the ones to manage the GEO submission. The submission process requires detailed knowledge of the experimental design, so the people who performed the experiment should be the ones to submit the data.

Required Data/Information

GEO requires both data and metadata for your submission. It is important that your metadata be complete and informative; these are what make datasets in public repositories useful.

You will also need to log in to GEO (requires an NCBI account) to initiate the submission process. You can initiate the submission process here: https://www.ncbi.nlm.nih.gov/geo/submitter/

Do make a note of the FTP URL and credentials (FTP username and FTP password) for later. You will need these for data transfer.

Required Data

The data required are the raw demultiplexed FASTQ files and the processed relative expression data. If you collected your data through the UMGC, then the raw data are the FASTQ files that are included in the data release from UMGC. If you processed your data through CHURP, then the cpm_list.txt normalized relative expression matrix and subread_counts.txt raw read counts matrix have the expression data that are required. Additionally, the MD5 sums for verifying file integrity are required; we will go over this in a later section.

The metadata required are given in the GEO submission template linked below (Example 1 is for ChIP-seq, and example 2 is for RNAseq):
https://www.ncbi.nlm.nih.gov/geo/info/seq.html#metadata

The required information includes:

*: This tutorial covers the data processing protocol! The read trimming, read mapping, alignment filtering, expression quantification, and expression normalization steps described in this tutorial describe the steps taken to handle the data.

Calculating MD5 Sums

The MD5 sums are required for all raw and processed data that will be deposited into GEO. These are strings that can be used to verify file integrity in non-cryptographic situations, e.g., to make sure the file you are using is not unintentionally corrupted.

If you are working on a funded collaboration with RI Bioinformatics, we can perform the MD5 sum calculation step for you!

You can perform this calculation on MSI’s compute servers. First, request an interactive compute session:

srun -N 1 -n 1 -c 1 --mem=2gb -t 4:00:00 -p interactive --pty bash -l

Once you have an interactive session, navigate to where your raw reads are stored. For this example, we will use the tutorial reads:

cd /home/msistaff/public/RNAseq_Tutorial/Reads

Then use the md5sum command to generate the checksums and write them to a file:

md5sum *.fastq.gz > ~/geo_submission_md5sums.txt

You can verify they were properly generated by passing the -c option to the md5sum command:

md5sum -c ~/geo_submission_md5sums.txt
BoneMarrow-1_S23_R1_001.fastq.gz: OK
BoneMarrow-1_S23_R2_001.fastq.gz: OK
BoneMarrow-2_S21_R1_001.fastq.gz: OK
BoneMarrow-2_S21_R2_001.fastq.gz: OK
BoneMarrow-3_S19_R1_001.fastq.gz: OK
BoneMarrow-3_S19_R2_001.fastq.gz: OK
BoneMarrow-4_S17_R1_001.fastq.gz: OK
BoneMarrow-4_S17_R2_001.fastq.gz: OK
Spleen-1_S31_R1_001.fastq.gz: OK
Spleen-1_S31_R2_001.fastq.gz: OK
Spleen-2_S29_R1_001.fastq.gz: OK
Spleen-2_S29_R2_001.fastq.gz: OK
Spleen-3_S27_R1_001.fastq.gz: OK
Spleen-3_S27_R2_001.fastq.gz: OK
Spleen-4_S25_R1_001.fastq.gz: OK
Spleen-4_S25_R2_001.fastq.gz: OK

Every file passes! The contents of the file are pasted below. The first column is the MD5 sum and the second column is the filename. The strings listed in the first column are what you would enter into your GEO submission sheet:

ee99e5e5262a0131451460845197378d  BoneMarrow-1_S23_R1_001.fastq.gz
b7ad1164d691010b397942cca8f6fc39  BoneMarrow-1_S23_R2_001.fastq.gz
614195cfc82221d93861ec265c627d29  BoneMarrow-2_S21_R1_001.fastq.gz
b49dc13ae696334525daa0b91fb1bda6  BoneMarrow-2_S21_R2_001.fastq.gz
ae2071b5c9f7e966a01e8c73779de204  BoneMarrow-3_S19_R1_001.fastq.gz
2208e126306480767354b135e9d3475b  BoneMarrow-3_S19_R2_001.fastq.gz
7c5168e84f55ba2bf6072ff2bbdb855b  BoneMarrow-4_S17_R1_001.fastq.gz
de2a0f9b67a61444cbd6d2bdd9840263  BoneMarrow-4_S17_R2_001.fastq.gz
e7900214eef5872f7797656933b32182  Spleen-1_S31_R1_001.fastq.gz
2d9fde82c0dc57fff855897eac1bc6b2  Spleen-1_S31_R2_001.fastq.gz
5d17363dc573b37c2c23c9acc592a200  Spleen-2_S29_R1_001.fastq.gz
9112d0acbb1f7eace510f00e72ddd828  Spleen-2_S29_R2_001.fastq.gz
821f8d7ed25d6e37a8a5bd0123193833  Spleen-3_S27_R1_001.fastq.gz
eebe5f6e30ab1fafd38426e20887a09e  Spleen-3_S27_R2_001.fastq.gz
b20468603ce262c38f5378e7feb580e8  Spleen-4_S25_R1_001.fastq.gz
5ba0d064a1bc09e7f38138f4fe55dec3  Spleen-4_S25_R2_001.fastq.gz

The process is the same for the raw read counts matrix and the normalized expression matrix.

Uploading Data to GEO

Now that you have the MD5 sums calculated and entered into your submission spreadsheet, you can upload the data files to GEO.

If you are working on a funded collaboration with RI Bioinformatics, we can upload the data for you, too!

If your data are larger than 1 terabyte (TB, 1000 GB) in volume, you must contact GEO and wait for a response from them before uploading the data.

Again, we can do this from the MSI compute node. First request an interactive compute session:

srun -N 1 -n 1 -c 1 --mem=2gb -t 4:00:00 -p interactive --pty bash -l

Then, navigate to the directory where your raw data are stored. This example has the tutorial dataset, but you should use your raw FASTQ folder:

cd /home/msistaff/public/RNAseq_Tutorial/Reads

We will then use an FTP client (lftp) to connect to the GEO upload location and put the files there. Fetch the FTP address and username and password that were provided to you by GEO. Use these to connect to the server, make a directory for your data uploads, and then upload the files. Note that there are no spaces between the USERNAME and PASSWORD in the following command, just a comma:

lftp -u USERNAME,PASSWORD ftp://ftp.ncbi.../uploads/
lftp ftp.ncbi.nlm.nih.gov:/uploads> mkdir my_submission
lftp ftp.ncbi.nlm.nih.gov:/uploads> cd my_submission
lftp ftp.ncbi.nlm.nih.gov:/uploads/my_submission> mput *.fastq.gz

Note that the lftp prompt shows you which server you are connected to and which directory you are in. Once these files are uploaded, you can use the lcd command to navigate to where your raw read counts and normalized expression matrices are stored. Upload these, too. Again, we will use the tutorial directory, but you should use your real data:

lftp ftp.ncbi.nlm.nih.gov:/uploads/my_submission> lcd /scratch.global/konox006/RNAseq_Tutorial/Out/Counts
lftp ftp.ncbi.nlm.nih.gov:/uploads/my_submission> put subread_counts.txt
lftp ftp.ncbi.nlm.nih.gov:/uploads/my_submission> put cpm_list.txt
lftp ftp.ncbi.nlm.nih.gov:/uploads/my_submission> bye

The bye command closes the FTP connection. Note that your terminal may print more output messages than what I have listed here. So long as you do not see errors, your command worked.

Using your favorite desktop FTP client (OSX Finder or Windows Explorer both work for this; if you are on Linux, then you can find an FTP client on your own), transfer your GEO metadata spreadsheet into the submission directory as well. You can transfer it through MSI servers via the same process above if you are more comfortable with it, but I find it more convenient to transfer from my workstation.

Notifying GEO of File Upload

Once your raw data, processed data, and metadata spreadsheet are uploaded, you can go to this link to notify GEO that your files are ready for review:
https://submit.ncbi.nlm.nih.gov/geo/submission/

If you have a funded collaboration with RI Bioinformatics, then we can do this step for you!

This form will require the following information:

Once you submit the form, wait for a response from GEO. They will contact you if any of the metadata are incomplete or if any files were corrupted during upload. Once everything checks out, they will send you a link to the study that you can include for peer review.

Glossary of Terms

This section describes the specialized terms that we use in this tutorial. I have tried to point out terms that may be used differently from how I use them in this tutorial.

Molecular Biology (Wet Bench) Terms

Bioinformatic Terms